Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139865617:139865634:[+]	chr11:2669066:2669084:[-]	nonBSJ supported	Exon	circRNA 5':UGUCUUCCAAUA-AUUUCA 3' \|\|\|\|:\| \|\|\|\|\| target 3':UCAGAGGAAAAAGUAAAGA 5'	-10.50	11	RIC-seq
chrX:139865678:139865703:[+]	chr11:2635326:2635341:[-]	nonBSJ supported	Exon	circRNA 5':CCAGAAAAAUCUGUGUCUUCCACCAA 3' \|\|\| \|\|:\|\| \|\| \|\|\|\|\| target 3':CGUC------GAUAC-GA--GUGGU 5'	-11.40	25	RIC-seq
chrX:139865682:139865698:[+]	chr11:2698956:2698972:[-]	nonBSJ supported	Exon	circRNA 5':AAAAAUC-UGUGUCUUCC 3' \|\|\|\|\| \|\| \|\|\|\|:\| target 3':AUUUUAAAAC-CAGAGGC 5'	-8.70	24	RIC-seq
chrX:139865901:139865908:[+]	chr11:2720084:2720091:[-]	nonBSJ supported	Exon	circRNA 5':UUCCGGAA 3' \|\|\|\|\|\| target 3':UGGGCCUG 5'	-9.20	2	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chrX:139865901:139865908:[+]	circRNA	-	chrX:139865903-139865904	C>T	LINC-JP	ICGC