Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866564:139866612:[+] chr1:119669247:119669303:[-] nonBSJ supported Exon

circRNA 5':AUAUG-UCUUC-CAACUAAGCUACGUC-----UUCCAA--CAAAUCCAUGUCUUCCUA 3'


            ||| :|||| | || ||||| |:| |:|||| ||||: | ||||||


target  3':GAUAAUGGAAGUGGUGCUUCGAGGUAUUCAAAAGGGUUAAGUUUGAUCCC-GAAGGAG 5'

 -24.90 1 RIC-seq
chrX:139866569:139866583:[+] chr1:119669296:119669307:[-] nonBSJ supported Exon

circRNA 5':UCUUCCAACUAAGCU 3'


            ||||| |||


target  3':CGAAGGAG---UCGU 5'

 -8.20 1 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chrX:139866564:139866612:[+] circRNA - chrX:139866592-139866593 C>A LICA-CN ICGC