Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139866695:139866728:[+]	chr6:127794057:127794090:[-]	nonBSJ supported	3UTR	circRNA 5':UCUUCCAGCAUCUUCAUGUCUUCCAACAACUACC 3' \| \|\|\|\|\|\| \|\|: \|\|\|\|\|\| target 3':GGCAGGUCGAAAACUUAUUAUUAUCACUUGAUGA 5'	-14.00	1	RIC-seq
chrX:139866697:139866728:[+]	chr6:127794059:127794090:[-]	nonBSJ supported	3UTR	circRNA 5':UUCCAGCAUCUUCAUGUCUUCCAACAACUACC 3' \|\|\|\|\|\| \|\|: \|\|\|\|\|\| target 3':CAGGUCGAAAACUUAUUAUUAUCACUUGAUGA 5'	-13.90	1	RIC-seq
chrX:139866759:139866794:[+]	chr6:127774992:127775027:[-]	nonBSJ supported	3UTR	circRNA 5':GUCUUCCAACGUCUCCAGUGUGC-UGAUCUUC---UGACA 3' \|\|\|\|\| \|\|\| \| \|\|\| \|:\|\|\|\|\|\| \|\|\|\| target 3':GAGAAGAUAAAAGA----AGACGUAUUAGAAGGUAACUGA 5'	-21.70	2	RIC-seq
chrX:139866021:139866038:[+]	chr6:127837456:127837472:[-]	nonBSJ supported	CDS	circRNA 5':AUCCACGUCUUCCCAACA 3' \|\|\|\|\| \|\|: \|\| \| target 3':GGGGUGGAGGC-GGAGGA 5'	-14.20	1	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chrX:139866759:139866794:[+]	circRNA	-	chrX:139866793-139866794	C>T	LICA-CN	ICGC