Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866777:139866817:[+] chr9:91617201:91617227:[+] nonBSJ supported CDS

circRNA 5':UGUGCUGAUCUUCUGACAUUCAGGUCUUCCAGUGUCUGCAA 3'


            |||||| : |||| |||| || ||||


target  3':UCACGAC-GCAAGAAC-----------AGGU-ACU-ACGUC 5'

 -18.00 2 RIC-seq
chrX:139865480:139865509:[+] chr9:91607060:91607081:[+] nonBSJ supported Intron

circRNA 5':CGGACAAUCCAUGUCUUCCAAGAAGCUCCA 3'


            |||| || ||||||| ||| ||


target  3':CCCUGA-AG---CAGAAGG----UCGUGGC 5'

 -20.70 2 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chrX:139866777:139866817:[+] circRNA - chrX:139866793-139866794 C>T LICA-CN ICGC