Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139865398:139865445:[+] chr14:105927238:105927290:[+] nonBSJ supported 5UTR

circRNA 5':CAAGUCUU-CCAAUAAUCUCA-AGGUCU--UCCAGAUAA-UCCUGAGCUUCCA 3'


            ||:|||| | ||: |::||: :||| ||| | ||||||


target  3':UUUUAGAACGACUUACAGGCACUUUAGGAAGGGUAUAAAAAGGUCCCGAAGGA 5'

 -25.10 1 RIC-seq
chrX:139866332:139866346:[+] chr14:105930774:105930787:[+] nonBSJ supported 5UTR

circRNA 5':AGGUCUUCCAGGAAA 3'


            || | :|||:|||


target  3':CCCUG-GGGUUCUUA 5'

 -12.30 2 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr14:105927238:105927290:[+] target - chr14:105927256-105927257 A>G PACA-CA ICGC