Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139865861:139865883:[+]	chr15:85197326:85197355:[-]	nonBSJ supported	Intron	circRNA 5':CGUCUUCCACCAAA------UCC-AGGUCU 3' \|\|\|:\|\|\|\|\| :\|\| \|\|\|:\| target 3':UCAGGAGGUGCCACCGCUCGGGGCUCCGGU 5'	-22.70	1	RIC-seq
chrX:139865861:139865888:[+]	chr15:85197309:85197335:[-]	nonBSJ supported	Intron	circRNA 5':CGUCUUCCACCAAAUCCAGGUCUUCCAG 3' \|:\|\| \|\|\| :\|\|\|:\|\|\|\| target 3':CCGGAUCCGGGUCCGCC-UCAGGAGGUG 5'	-20.00	11	RIC-seq
chrX:139865861:139865889:[+]	chr15:85197326:85197360:[-]	nonBSJ supported	Intron	circRNA 5':CGUCUUCCACCAAA------UCC-AGGUCUUCCAGU 3' \|\|\|:\|\|\|\|\| :\|\| \|\|\|:\| \|\|\|: target 3':UCAGGAGGUGCCACCGCUCGGGGCUCCGGU--GUCGA 5'	-25.70	12	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr15:85197326:85197355:[-]	target	-	chr15:85197337-85197338	G>A	EOPC-DE	ICGC
chr15:85197326:85197360:[-]	target	-	chr15:85197337-85197338	G>A	EOPC-DE	ICGC