Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866509:139866567:[+] chr1:19953062:19953096:[+] nonBSJ supported Exon

circRNA 5':UCCACGUCUUC-CAACCAAGCCAUGUCUUCCAGAAAAUCCACGUCUUCCAGAAAAUAUAU 3'


            |||| ||:| |||| ||||||| ||||||||:|


target  3':UGGUGGAGGAAUGUUG-----------AAGGUCUC--------------UCUUUUAUGUU 5'

 -25.50 7 RIC-seq
chrX:139866515:139866567:[+] chr1:19953062:19953092:[+] nonBSJ supported Exon

circRNA 5':UCUUCCAACCAAGCCAUGUCUUCCAGAAAAUCCACGUCUUCCAGAAAAUAUAU 3'


            |:||| ||| |||||||| ||||||||:|


target  3': GGAGGAAUGUU-------GAAGGUCUC--------------UCUUUUAUGUU 5'

 -20.50 1 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr1:19953062:19953092:[+] target - chr1:19953064-19953065 G>T LICA-CN ICGC
chr1:19953062:19953096:[+] target - chr1:19953064-19953065 G>T LICA-CN ICGC