Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866117:139866145:[+] chr3:179085253:179085273:[+] nonBSJ supported CDS

circRNA 5':AUCUUCCAAUGGCCUCCAGGUCUUCCAGA 3'


            ||:|||| |||:| |||


target  3': AGGAGGU-------GGUUCUUUACGUCC 5'

 -15.40 1 RIC-seq
chrX:139866476:139866514:[+] chr3:179093082:179093116:[+] nonBSJ supported CDS

circRNA 5':AUGUCUUCCAACAAAGGU--ACGUCUUCCAGAAAAUC---CACG 3'


            ||:| |||| || |||| |||


target  3':GACGG---------UCCAAAUGACUUAGGUAAUACAAAAAGUGU 5'

 -10.60 2 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr3:179093082:179093116:[+] target - chr3:179093097-179093098 G>A LINC-JP ICGC