Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139865380:139865395:[+]	chr8:140742923:140742938:[-]	nonBSJ supported	3UTR	circRNA 5':CGGGUCUUCCAGCGAC 3' \|:\|\|\| :\|\|\| target 3':CUUCAGCGACCUGCUC 5'	-7.50	1	RIC-seq
chrX:139865391:139865438:[+]	chr8:141034079:141034115:[-]	nonBSJ supported	CDS	circRNA 5':GCGACUUCAAGUCUUCCAAUAAUCUCAAGGUCUUCCAGAUAAUCCUGA 3' \|\|\|\|\|\|\| \| \|\| :\|:\|\| \|\| \|\|\|\| \|\|\|\|\| target 3':AGCUGAAGAU--GUACGUC---GGGGUCCCUC----UCUA--AGGACA 5'	-19.80	27	RIC-seq
chrX:139865418:139865445:[+]	chr8:141034093:141034113:[-]	nonBSJ supported	CDS	circRNA 5':AGGUCUUCCAGAUAAUCCUGAGCUUCCA 3' \|\|:\| \|\|\|\| \|\|\| \|\|\|\| target 3':GUCGG--GGUCCCU-----CUCUAAGGA 5'	-13.10	1	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr8:140742923:140742938:[-]	target	-	chr8:140742929-140742930	G>A	LAML-KR	ICGC