Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139865749:139865791:[+]	chr1:90473116:90473147:[+]	nonBSJ supported	CDS	circRNA 5': CUUCCAGUCAAUCAGUGUCUUCCAGAAAGAAAUCCAGGUCUUC 3' \|\|\|\|\| \|\|\|\|:\|\|\|\| \|\|\|:\|\|\|\|\|:\|\|: target 3':AGAAGGAG--------ACAGGAGGUA----UUUGGGUCCGGAGU 5'	-34.60	1	RIC-seq
chrX:139865788:139865830:[+]	chr1:90473116:90473147:[+]	nonBSJ supported	CDS	circRNA 5': CUUCCAGUCAAUCAGUGUCUUCCAGAAAGAAAUCCAGGUCUUC 3' \|\|\|\|\| \|\|\|\|:\|\|\|\| \|\|\|:\|\|\|\|\|:\|\|: target 3':AGAAGGAG--------ACAGGAGGUA----UUUGGGUCCGGAGU 5'	-34.60	1	RIC-seq
chrX:139865825:139865850:[+]	chr1:90478709:90478734:[+]	nonBSJ supported	CDS	circRNA 5': GUCUUCCAGUCAGUCAGUG--UCUUCCA 3' \|:\|\| \|\|:\| \|:\| \|: \|\|\|\|\|\| target 3':UCGGA--GUUAAGCGG-CGAAAAGAAGGA 5'	-17.40	1	RIC-seq
chrX:139865837:139865850:[+]	chr1:90478709:90478724:[+]	nonBSJ supported	CDS	circRNA 5': GUCAGUG--UCUUCCA 3' \|:\| \|: \|\|\|\|\|\| target 3':GCGG-CGAAAAGAAGGA 5'	-11.60	1	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr1:90473116:90473147:[+]	target	-	chr1:90473117-90473118	G>T	RECA-EU	ICGC