Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139866349:139866372:[+]	chr17:64805694:64805715:[+]	nonBSJ supported	3UTR	circRNA 5':CGUGUCUUCCAGCAAAUCCACGUC 3' \|\|\|: \|\|\|\|\|\| \|:\|\|\| \|: target 3':CCACG--AGGUCGACUGGGUCCGA 5'	-21.60	1	RIC-seq
chrX:139865523:139865555:[+]	chr17:64784982:64785018:[+]	nonBSJ supported	CDS	circRNA 5':AUCAAGUCU-----UCCAGCAAAUCCAGUCUUCCAGCA 3' \|\|\| \|\|\|: :\|\| \|\| :\|\|\| :\|\|\|\|\| target 3':GAGUGCAGGGAGAGGGGGAGUCCGGGUGUC-GGGUCGG 5'	-23.50	1	RIC-seq
chrX:139865527:139865552:[+]	chr17:64785038:64785065:[+]	nonBSJ supported	CDS	circRNA 5':AGUCUUCCAGCAAA-UCCAGUCU-UCCA 3' \|\| :\|\|\|\|\| :\|\|\|\|\|\| \|\|\| target 3':ACAAGAGGUCAAAAAGGGUCAGCUAGGA 5'	-23.10	1	RIC-seq
chrX:139865527:139865555:[+]	chr17:64785035:64785065:[+]	nonBSJ supported	CDS	circRNA 5':AGUCUUCCAGCAAA-UCCAGUCU-UCCAGCA 3' \|\| :\|\|\|\|\| :\|\|\|\|\|\| \|\|\| \| target 3':ACAAGAGGUCAAAAAGGGUCAGCUAGGAGGC 5'	-23.40	37	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr17:64784982:64785018:[+]	target	-	chr17:64784994-64784995	G>T	LICA-CN	ICGC