Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA 3' interaction region CircRNA 5' interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866774:139866794:[+] - chr18:24717341:24717356:[-] BSJ supported Intron

circRNA 5':CAGUGUGCUGAUCUUCUGACA 3'


            || |::||||| ||||


target  3':CUC-CGUGACUA----ACUGA 5'

 -13.60 1 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chrX:139866774:139866794:[+] circRNA - chrX:139866793-139866794 C>T LICA-CN ICGC