Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866579:139866591:[+] chr10:129160335:129160347:[+] nonBSJ supported CDS

circRNA 5':AAGCUACGUCUUC 3'


            |:|| :||||


target  3':CUUGAAAUAGAAC 5'

 -5.40 1 RIC-seq
chrX:139866579:139866602:[+] chr10:129160327:129160347:[+] nonBSJ supported CDS

circRNA 5':AAGCUACGUCUUCCAACAAAUCCA 3'


            |:|| :|||| ||


target  3':CUUGAAAUAGAACACAACU--GG 5'

 -6.00 10 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chrX:139866579:139866602:[+] circRNA - chrX:139866592-139866593 C>A LICA-CN ICGC