Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA 3' interaction region	CircRNA 5' interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139866801:139866824:[+]	chrX:139865339:139865353:[+]	chr8:25166379:25166424:[+]	BSJ supported	CDS	circRNA 5':UCUUCCAGUGUCUGCAAUAUC------CAGGGGUUUCC-GA-UGGCA 3' \|\|\|\|\| \|\| \|\|\|\|\|\|\| \| \|\|:\|: \| \|\| \|\|\|\| target 3':UGAAGGAAAC-GACGUUAGUGAAAUAAGUUCUGACUUCACUCACCGA 5'	-26.00	25	RIC-seq
chrX:139866808:139866824:[+]	chrX:139865339:139865362:[+]	chr8:25265610:25265648:[+]	BSJ supported	CDS	circRNA 5':GUGUCUGCAAUAUCCAGGGGUUUCCGAUGGCACCUGUGUCA 3' \| \|\|\|\|\|\|\|\| \|\| \|\|\|::\|\| \| \|:\| \|\| \|\|\| target 3':AAGAGACGUUACUGGACCCUGAACGAGUCUGAGGU--CAGA 5'	-29.20	2	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr8:25265610:25265648:[+]	target	-	chr8:25265618-25265619	G>T	LICA-CN	ICGC