Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139865408:139865445:[+] chr7:28792147:28792179:[+] nonBSJ supported Intron

circRNA 5':AAUAAUCUCAAGGUCUUCCAGAUAAUCCUGAGCUUCCA 3'


            |||| || |||| ||||| || ||||


target  3':GUAUUCAAG-UCCA-AAGGUACGCUU---CUAAAAGGA 5'

 -16.80 2 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr7:28792147:28792179:[+] target - chr7:28792159-28792160 G>A LAML-KR ICGC