Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866342:139866391:[+] chr15:84287146:84287183:[+] nonBSJ supported 3UTR

circRNA 5':GGAAAUCCGUGUCUUCC--AGCAAAUCCACGUCUUCCAACAAAGCCAUGUCU 3'


            ||||| |:| |||| |||:| |||||: |||


target  3':AUUUUAUGUAAUAUUUCUCUCGU----GUGUA------UGUUUU----CAGU 5'

 -11.30 1 RIC-seq
chrX:139866366:139866391:[+] chr15:84287146:84287161:[+] nonBSJ supported 3UTR

circRNA 5':CCACGUCUUCCAACAAAGCCAUGUCU 3'


            |||:| |||||: |||


target  3':UGUGUA------UGUUUU----CAGU 5'

 -7.00 1 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr15:84287146:84287183:[+] target - chr15:84287164-84287165 T>C PACA-CA ICGC