Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139865869:139865907:[+]	chr6:3224902:3224925:[-]	nonBSJ supported	3UTR	circRNA 5':ACCAAAUCCAGGUCUUCCAGUCAAUCCACAUCUUCCGGA 3' \|\|\| \|\|\|\|\|\| \|\| \|\|\| \|\|\|\| target 3': GGUGACGGUCCAAUAG--CAG------------GGCCC 5'	-21.30	2	RIC-seq
chrX:139866205:139866252:[+]	chr6:3226819:3226851:[-]	nonBSJ supported	CDS	circRNA 5':CGGGUCU-UCCAGGAAAUCCGUGUCUUCCAGCAAGUCCAC-GUCUUCCAA 3' \|: \|\|\| \|\|\|\|\| \|\|\|\|:\| \|\|\| \|\|\| \|\|\|\| target 3':ACUAAGAGAGGUCGA---------------CGUUUA-GUGACAG-AGGUA 5'	-24.20	2	RIC-seq
chrX:139866329:139866359:[+]	chr6:3226794:3226828:[-]	nonBSJ supported	CDS	circRNA 5':UCCAG-GUCUUCC----AGGAAAUCCGUG-UCUUCCA 3' \|\|\|\| \| \|\|\|\| \|\| \|\|: \|\|\|: \| target 3': GGUCACCGAAGUAACAUCAUUUGUAACUAAGAGAG 5'	-10.00	1	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chrX:139865869:139865907:[+]	circRNA	-	chrX:139865903-139865904	C>T	LINC-JP	ICGC