Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139865480:139865514:[+] chr11:61607955:61607990:[+] nonBSJ supported 5UTR

circRNA 5':CGGACAAU--CCAUGUCUUCCAAGAAGCUCCAAGUCU 3'


            |||||| || || ||| ||:|


target  3':UCCUGUUUCCGGCACUACUCCCAUCCUUAGG-UCGGU 5'

 -17.10 1 RIC-seq
chrX:139865534:139865547:[+] chr11:61607955:61607995:[+] nonBSJ supported 5UTR

circRNA 5':CAGCA--------------------------AAUCCAGUC 3'


            |||| |||||||:|


target  3':AUCGUUCCUGUUUCCGGCACUACUCCCAUCCUUAGGUCGGU 5'

 -12.80 1 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr11:61607955:61607990:[+] target - chr11:61607961-61607962 G>T LICA-CN ICGC
chr11:61607955:61607995:[+] target - chr11:61607961-61607962 G>T LICA-CN ICGC