Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866317:139866362:[+] chr1:46751225:46751249:[-] nonBSJ supported CDS

circRNA 5':GCUUCCGAAAAAUCCAGGUCUUCCAGGAAAUCCGUGUCUUCCAGCA 3'


           |||||| |||: |||:| ||||| ||


target  3':UGAAGG----------------GGUUAG--AGGUAGAGAAG--CG 5'

 -23.90 2 RIC-seq
chrX:139866761:139866778:[+] chr1:46762605:46762636:[-] nonBSJ supported Exon

circRNA 5': CUUC-C------------AACGUCUCCAGUG 3'


            |||| | |||:||||||||


target  3':AGAAGAGAAAAAGUCCUUUUUGUAGAGGUCAA 5'

 -19.40 1 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chrX:139866317:139866362:[+] circRNA - chrX:139866318-139866319 C>T BTCA-JP ICGC