Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139866399:139866427:[+]	chr16:58620587:58620603:[-]	nonBSJ supported	CDS	circRNA 5':AAUUAAUGUCUUCCAGCCUACUUGUGUCU 3' \|:\| \|:\|\|\| \|\|:\|\|\| target 3':GUGACUGCAG------------ACGCAGU 5'	-10.20	2	RIC-seq
chrX:139866404:139866427:[+]	chr16:58620579:58620603:[-]	nonBSJ supported	CDS	circRNA 5':AUGUCUUCCAGCCUAC-UUGUGUCU 3' \|\| \|\|\|\|\| :\|\|:\|\|\| target 3':AACUAAAGGUGACUGCAGACGCAGU 5'	-14.60	2	RIC-seq
chrX:139866404:139866427:[+]	chr16:58620580:58620603:[-]	nonBSJ supported	CDS	circRNA 5':AUGUCUUCCAGCCUAC-UUGUGUCU 3' \|\| \|\|\|\|\| :\|\|:\|\|\| target 3': ACUAAAGGUGACUGCAGACGCAGU 5'	-14.10	1	RIC-seq
chrX:139866408:139866427:[+]	chr16:58620583:58620603:[-]	nonBSJ supported	CDS	circRNA 5':CUUCCAGCCUAC-UUGUGUCU 3' \|\|\|\|\| :\|\|:\|\|\| target 3':AAAGGUGACUGCAGACGCAGU 5'	-13.70	37	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr16:58620579:58620603:[-]	target	-	chr16:58620594-58620595	G>T	LICA-CN	ICGC
chr16:58620580:58620603:[-]	target	-	chr16:58620594-58620595	G>T	LICA-CN	ICGC
chr16:58620583:58620603:[-]	target	-	chr16:58620594-58620595	G>T	LICA-CN	ICGC
chr16:58620587:58620603:[-]	target	-	chr16:58620594-58620595	G>T	LICA-CN	ICGC