Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866654:139866696:[+] chr20:62126271:62126294:[-] nonBSJ supported CDS

circRNA 5':GCUCGUCUUCCAACAUCUCCACGUCUUCCAGCAUCUCUGUGUC 3'


            |||||| || |||| |||


target  3':AGAGCAGCAUCG------------------CGAAGAGCGACA 5'

 -15.80 2 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr20:62126271:62126294:[-] target 967313 chr20:62126274-62126275 C>T Developmental_and_epileptic_encephalopathy,_33|not_provided ClinVar
chr20:62126271:62126294:[-] target - chr20:62126275-62126276 G>A LAML-KR ICGC