Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139866677:139866714:[+]	chr2:26179233:26179255:[-]	nonBSJ supported	CDS	circRNA 5':UCUUCCAGCAUCUCUGUGUCUUCCAGCAUCUUCAUGUC 3' \|\|\| \|\|\| \|\|\|\|\|:\|\|\|\|\|\|\| \|\|: target 3': GAA-GUC------------AAGGUUGUAGAAG-ACGA 5'	-22.10	7	RIC-seq
chrX:139866677:139866718:[+]	chr2:26179233:26179260:[-]	nonBSJ supported	CDS	circRNA 5':UCUUCCAGCAUCUCUGUGUCUUCCAGCAUCUUCAUGUC-UUCC 3' \|\|\| \|\|\| \|\|\|\|\|:\|\|\|\|\|\|\| \|\|: \|\|\| target 3': GAA-GUC------------AAGGUUGUAGAAG-ACGACAAGC 5'	-22.60	7	RIC-seq
chrX:139866743:139866771:[+]	chr2:26179216:26179249:[-]	nonBSJ supported	CDS	circRNA 5':CUGGCUCAAUAUCCAUGUCU-------UCCAACGUC 3' \|\|\|\| \|\|\| \|\|:\|\| \|\|\|\|\|\|:\|\| target 3':AGCCGUUAG--AGG-ACGGAGAAGUCAAGGUUGUAGA 5'	-24.60	1	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr2:26179233:26179260:[-]	target	-	chr2:26179260-26179261	G>A	EOPC-DE	ICGC