Gene structure and interaction sites

5'UTR

CDS

3'UTR

Exon

circRNA binding site

Detailed information

CircRNA interaction region	Target interaction region	Interaction type	Target element	RNA duplex	MFE (kcal/mol)	Reads	Methods
chrX:139865821:139865845:[+]	chr12:12269516:12269544:[-]	nonBSJ supported	3UTR	circRNA 5': CCAGGUCUUCCAG-UCAGUC--AGUGUC 3' \|\|\|:: \|\|\| \|\|\|\|: \|\|:\|: target 3':UGGUUUUACCUGUCAAGUCGUUUUCGCGC 5'	-17.00	1	RIC-seq
chrX:139865821:139865860:[+]	chr12:12269516:12269559:[-]	nonBSJ supported	3UTR	circRNA 5': CCAGGUCUUCCAG-UCAGUC--AGUGUCUUCCAGAAAAAUCUA 3' \|\|\|:: \|\|\| \|\|\|\|: \|\|:\|: \|\|\| target 3':UGGUUUUACCUGUCAAGUCGUUUUCGCGCAACAGACAUUAAGAG 5'	-17.10	1	RIC-seq
chrX:139866629:139866658:[+]	chr12:12332843:12332871:[-]	nonBSJ supported	CDS	circRNA 5':AGCAUCUCCAGGGCU-UCCAGCAUCUGCUCG 3' \|\|\|: \|\|\|::\|: \|\|\|\|\| \| \|\|\|\|\|\| target 3':AUGUGCCAGUCUUGGUAGGUC-UCGACGAG 5'	-28.40	2	RIC-seq

Variants map to interaction

Interaction region	CircRNA/target	Mutation ID	Position	Variant	Associated trait	Resource
chr12:12332843:12332871:[-]	target	-	chr12:12332848-12332849	G>A	LINC-JP	ICGC