Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866311:139866322:[+] chr20:44996091:44996102:[-] nonBSJ supported CDS

circRNA 5':UCCAUAGCUUCC 3'


            || :||||||


target  3':CGGCGUCGAAGU 5'

 -11.90 6 RIC-seq
chrX:139866311:139866331:[+] chr20:44996091:44996108:[-] nonBSJ supported CDS

circRNA 5':UCCAUAGCUUCCGAAAAAUCC 3'


            || :|||||| |||


target  3':CGGCGUCGAAGUAG----AGGU 5'

 -12.20 10 RIC-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chrX:139866311:139866322:[+] circRNA - chrX:139866318-139866319 C>T BTCA-JP ICGC
chrX:139866311:139866331:[+] circRNA - chrX:139866318-139866319 C>T BTCA-JP ICGC