Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139865898:139865934:[+] chr8:92051568:92051604:[-] nonBSJ supported Intron

circRNA 5':AUCUU----CCGGAAAAAAUC-CAGGUCUUCCAGCCAAUAUA 3'


            |||: || || ||:|:| || |:|:


target  3':GAGAGACACGGAAUAA---AGAGUUCGGUAC--CGAGUGUGA 5'

 -11.50 2 KARR-seq
chrX:139865917:139865930:[+] chr8:92051575:92051594:[-] nonBSJ supported Intron

circRNA 5':GGUCU------UCCAGCCAA 3'


            |:|| || |||||


target  3':ACGGAAUAAAGAGUUCGGUA 5'

 -10.40 1 KARR-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr8:92051568:92051604:[-] target - chr8:92051589-92051590 A>C PACA-CA ICGC
chr8:92051575:92051594:[-] target - chr8:92051589-92051590 A>C PACA-CA ICGC
chrX:139865898:139865934:[+] circRNA - chrX:139865903-139865904 C>T LINC-JP ICGC