Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139865967:139865992:[+] chr8:17942833:17942859:[+] nonBSJ supported Exon

circRNA 5':UCCAUGU-CUUCCAGAAAAUCCAUGUC 3'


            |||| | || ||||:


target  3':UGGUAGACGAUCGAAUGACAAGUACGU 5'

 -8.80 2 KARR-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr8:17942833:17942859:[+] target - chr8:17942849-17942850 T>C LAML-KR ICGC