Gene structure and interaction sites

 5'UTR

 CDS

 3'UTR

 Exon

 circRNA binding site

Detailed information
CircRNA interaction region Target interaction region Interaction type Target element RNA duplex MFE (kcal/mol) Reads Methods
chrX:139866605:139866644:[+] chr17:80012436:80012462:[+] nonBSJ supported CDS

circRNA 5':UCUUCCUAUAUCUCCAGGUCUUCCAGCAUCUCCAGGGCUU 3'


            |:||| :|||||:| |||||||||


target  3': GGAGGU-----GGGUCCGGCAC-------AGGUCCCGAC 5'

 -30.50 1 KARR-seq
chrX:139866605:139866644:[+] chr17:80012436:80012463:[+] nonBSJ supported CDS

circRNA 5':UCUUCCUAUAUCUCCAGGUCUUCCAGCAUCUCCAGGGCUU 3'


            |:||| :|||||:| |||||||||


target  3':CGGAGGU-----GGGUCCGGCAC-------AGGUCCCGAC 5'

 -30.90 1 KARR-seq
Variants map to interaction
Interaction region CircRNA/target Mutation ID Position Variant Associated trait Resource
chr17:80012436:80012462:[+] target - chr17:80012449-80012450 G>A LICA-CN ICGC
chr17:80012436:80012463:[+] target - chr17:80012449-80012450 G>A LICA-CN ICGC